Validation of satisfaction questionnaire for services provided in the labour rooms of government health facilities.

INTRODUCTION AND OBJECTIVES: Using the assessment of satisfaction of patients of labour room services, the caregiver or policymakers can identify the gaps in the implemented programmes and health policies. This study was aimed to design a valid and reliable satisfaction questionnaire that will help in identifying the aspects of gaps that need improvement. METHODS: A facility and community-based observational cross-sectional study was conducted in the district of western Uttar Pradesh (India) between January 2019 and August 2020. Validation of the structured questionnaire with 34 dichotomous questions categorized under five subscales was performed by evaluating its validity and reliability. A total of 380 beneficiaries were selected from 48 government health facilities. RESULTS: The calculated Content validity index was calculated to be 9.5 which was adequate as per the guidelines. The reliability analysis of the questionnaire showed that the internal consistency was high with an overall Cronbach's alpha of 0.710. The variation in Cronbach's alpha on the elimination of any question from the questionnaire ranged from 0.676 to 0.767. The mean patient satisfaction score in the total surveyed population was 24.39±4.684 (total score=34) and there was a greater variation in the satisfaction score of infrastructure when compared with other subscales. CONCLUSION: The findings from this study support the reliability and validity of the patient satisfaction questionnaire as it is capable of evaluating the satisfaction in terms of delivery services provided in labour rooms as a whole.

Health-related quality of life of multidrug-resistant tuberculosis patients: A study of eastern Uttar Pradesh, India.

INTRODUCTION: Much attention has been given to the microbiological aspect, drug treatment, and clinical indicators of MDR-TB, but patients' QOL has remained a neglected area. In this study, we aimed to find the quality of MDRTB on various quality of life domains during the initiation of the MDR Treatment regimen. MATERIALS & METHODS: A cross-sectional study was conducted over a period of 6 months at the Drug-Resistance Tuberculosis Management Centre (DR-TB Centre), of a tertiary care centre in the eastern Uttar pradesh, India. Patients with age >18 years diagnosed with MDR-TB (Multidrug resistance TB) were included in the study. The WHO QOL-BREF scale was used to assess the health-related quality of life of patients. Data were analyzed using SPSS version 21. The institutional ethical review committee approved the study, and consent was taken before the participation of patients. RESULTS: A total of 157 patients were included in the study & 45.85% were dissatisfied with their condition. Social domain of WHO QOL-BREF is having the lowest mean score (28.51 ± 15.4) while psychological has high mean values (39.92 ± 6.91). There was a significant difference in the physical health domain with respect to age (p-value 0.001). Similar differences have been seen in the psychological domain regarding patient sex (p-value 0.001), smoking and alcohol within the social domain, and loss of income in the environmental domain. CONCLUSION: The mean value of different domains of WHO QOL-BREF is low in MDR-TB patients, with social relation domain being the most affected.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Expression of cry1Aa gene in cabbage imparts resistance against diamondback moth (Plutella xylostella).

Brassica oleracea cv. Pride of India is one of the most promising vegetable cultivars commercially grown as cash crop in Himachal Pradesh, India. However, its overall production is severely hampered by diamondback moth (Plutella xylostella), a notorious pest. To avoid yield losses caused by this pest, cryIAa gene was introduced into cabbage cv. Pride of India using Agrobacterium-mediated transformation method. In an attempt to maximize the transformation frequency, critical determinant factors such as explant type, pre-incubation and co-cultivation period, and acetosyringone effect were successfully optimized. The highest transformation frequency (4.67% and 14.50%) in cotyledon and hypocotyl explant was achieved with a pre-incubation period of 72 h and co-cultivation period of 48 h. Furthermore, transformation frequency was enhanced in cotyledon (18.66%) and hypocotyl (32.00%) explants, when selective regeneration medium was fortified with 100 µM acetosyringone, respectively. The transgene (cryIAa) integration and copy number were confirmed using PCR and Southern blotting. Reverse transcriptase PCR and quantitative real-time PCR analyses were performed that proved transcriptional expression of cryIAa gene in PCR-positive transgenic events. Transgenic cabbage-fed diamondback moth larvae showed significantly higher mortality, thereby proving transgene effectiveness against insect pest control.

Real-time tracking of single-molecule collagenase on native collagen and partially structured collagen-mimic substrates.

The dynamic interactions of an individual matrix metalloproteinase-1 were imaged and monitored in the presence of either triple-helical or non-triple-helical, partially structured collagen-mimic substrates. The enzyme exhibited ten-fold increased catalytic turnover rates with the structurally modified substrate by skipping the triple-helix unwinding step during the catalytic pathway.

Epidemiological profile of multidrug-resistant tuberculosis patients in Gorakhpur Division, Uttar Pradesh, India.

INTRODUCTION: Multidrug-resistant tuberculosis (MDR-TB) poses a major threat to control of TB worldwide. Adequate information on socioepidemiological factors and their interaction is required for its control. The aim was to study the social and epidemiological profile of MDR-TB patient in Gorakhpur division. METHODOLOGY: A cross-sectional study of 157 MDR-TB patients from Gorakhpur division admitted at DR-TB Center of a tertiary care center were interviewed during initiation of MDR-TB treatment using structured questionnaire and collected data were described using descriptive statistics. RESULTS: More than 2/3rd of patients were male and the mean age was 32.15 ± 13.19 years. Overcrowding was present in 82.8% of households and ventilation of living room was inadequate in 72.7% of households. About 21.7% had history of contact with TB cases. Two-third of the patients practice unhygienic sputum disposal practices at home and at public places it was more than 90%. More than 60% of patients have the history of irregular treatment in intensive phase and 80% in continuation phase. Nearly 68.8% of patients were resistance to isoniazid (H) and rifampicin (R) and 18.5% were resistance to H, R, and S (streptomycin) followed by H, R and E (Ethambutol). Nearly 3.8% of patients were HIV positive and 7% had history of diabetes. 64.3% were under severe thinness category according to the WHO classification. CONCLUSION: Study point out need of nutritional counseling and support throughout the treatment. Use of incentives, enhancing contact tracing and increasing awareness regarding sputum disposal practices are recommended for effective control.

Assessment of genetic diversity in lettuce (Lactuca sativa L.) germplasm using RAPD markers.

The importance of germplasm characterization is an important link between the conservation and utilization of plant genetic resources in various breeding programmes. In the present study, genetic variability and relationships among 25 Lactuca sativa L. genotypes were tested using random amplified polymorphic DNA (RAPD) molecular markers. A total of 45 random decamer oligonucleotide primers were examined to generate RAPD profiles, out of these reproducible patterns were obtained with 22 primers. A total of 87 amplicon were obtained, out of which all were polymorphic and 7 were unique bands. The level of polymorphism across genotypes was 100% as revealed by RAPD. Genetic similarity matrix, based on Jaccard's coefficients ranged from 13.7 to 84.10% indicating a wide genetic base. Dendrogram was constructed by unweighted pair group method with arithmetic averages method. RAPD technology could be useful for identification of different accessions as well as assessing the genetic similarity among different genotypes of lettuce. The study reveals the limited genetic base and the needs to diversify using new sources from the germplasm.

High frequency regeneration of plants from cotyledon and hypocotyl cultures in Brassica oleracea cv. Pride of India.

Morphogenic potential of cabbage cv. Pride of India, for multiple shoot induction was tested under in vitro conditions using cotyledon and hypocotyl explants. Aseptically grown seven to nine days old seedlings of cabbage were used as source of explants for reproducible plant regeneration studies. Forty different concentrations and combinations of TDZ (alone), TDZ with adenine, TDZ with NAA and TDZ with IAA were tried. Maximum shoot regeneration response from cotyledon explants (91.11%) and hypocotyl (94.40%) was obtained on MS medium containing 0.330 mg/l TDZ + 79.70 mg/l Adenine and 0.220 mg/l TDZ + 0.088 mg/l IAA, respectively. Rooting was achieved within two to three weeks on all the rooting media, but MS medium containing 0.10 mg/l NAA produced the maximum number of strong and healthy roots (100%). The regenerated complete plantlets with healthy roots and shoot system were transferred to pots containing sterilized cocopeat and successfully acclimatized and no phenotypic variations were observed among regenerated plants. Highly efficient, reproducible plant regeneration protocol has been standardized in cabbage cv. Pride of India, which would be valuable for Agrobacterium-mediated gene transfer studies in cabbage.

Nuclear Localizing Peptide-Conjugated, Redox-Sensitive Polymersomes for Delivering Curcumin and Doxorubicin to Pancreatic Cancer Microtumors.

Improving the therapeutic index of anticancer agents is an enormous challenge. Targeting decreases the side effects of the therapeutic agents by delivering the drugs to the intended destination. Nanocarriers containing the nuclear localizing peptide sequences (NLS) translocate to the cell nuclei. However, the nuclear localization peptides are nonselective and cannot distinguish the malignant cells from the healthy counterparts. In this study, we designed a "masked" NLS peptide which is activated only in the presence of overexpressed matrix metalloproteinase-7 (MMP-7) enzyme in the pancreatic cancer microenvironment. This peptide is conjugated to the surface of redox responsive polymersomes to deliver doxorubicin and curcumin to the pancreatic cancer cell nucleus. We have tested the formulation in both two- and three-dimensional cultures of pancreatic cancer and normal cells. Our studies revealed that the drug-encapsulated polymeric vesicles are significantly more toxic toward the cancer cells (shrinking the spheroids up to 49%) compared to the normal cells (shrinking the spheroids up to 24%). This study can lead to the development of other organelle targeted drug delivery systems for various human malignancies.

Real-time monitoring of conformational transitions of single-molecule histone deacetylase 8 with nanocircuits.

Using single-molecule approaches, we directly observed the dynamic interaction between HDAC8 and various ligands as well as conformational interconversions during the catalytic reaction. Statistical analysis identified key kinetic parameters, demonstrating that the enzymatic activity is highly sensitive to both minor variations in the ligand structures and small synthetic molecules.

Insulin Resistance in Young Obese Subjects and Its Relation to Smoking (A Pilot Study).

Insulin resistance is a condition in which cells fail to respond to the normal actions of insulin. Dietary fat, obesity and smoking have been attributed to increase insulin resistance. However, the prevalence of insulin resistance in young obese subjects and its relation to smoking is not well established. This study comprising seventy-five healthy young adults was undertaken to find insulin resistance in obese smokers and non smokers both. Present study showed an overall prevalence of raised homeostatic model assessment of insulin resistance in 14.7 % otherwise healthy young subjects (20-30 years age group). Non-smokers did not show any significant correlation between insulin resistance and body mass index at either stage (normal, pre-obese as well as obese). Smokers also did not show any significant difference of insulin resistance in normal and pre-obese stages. However, marked increase in homeostatic model assessment of insulin resistance was observed in obese smokers. Homeostatic model assessment of insulin resistance showed a linear trend in relation to body mass index and its values were found to be higher in smokers. Obesity combined with smoking demonstrated statistically significant increase in homeostatic model assessment of insulin resistance.

Long-term functional outcomes and quality of life in adult survivors of childhood extremity sarcomas: a report from the St. Jude Lifetime Cohort Study.

PURPOSE: This study compared measured physical performance, health-related quality of life (HRQOL), and social role attainment between extremity sarcoma survivors and controls, and evaluated associations between disease and treatment exposures, health conditions, and performance measures. METHODS: Survivors of extremity sarcoma from the St. Jude Lifetime cohort and controls frequency matched by age-, sex-, and race completed physical performance testing and questionnaires. Survivors with Z-scores on outcome measures ≤ -2.0 SD (compared to controls) were categorized with severe impairment/limitation. RESULTS: Among 206 survivors (52.4 % male median age 36 years (range 19-65)), 37 % had low relative lean mass, 9.7 % had an ejection fraction <50 %, 51.5 % had diffusion capacity for carbon monoxide <75 %, 27.7 % had sensory and 25.2 % motor neuropathy, and 78.2 % had musculoskeletal complications. Severe impairments/limitations were present among ≥25 % of survivors on fitness, balance, and physical HRQOL measures, and among ≥15 % on strength and activity of daily living measures. Lower extremity tumor location (OR 8.23, 95 % CI 2.54-26.67, P value 0.0004) and amputation (OR 8.07, 95 % CI 3.06-21.27, P value <0.0001) were associated with poor fitness. Poor fitness was associated with increased odds of scoring <40 on the SF-36 physical component summary (OR 4.83, 95 % CI 1.95-11.99, P value 0.001) and role-physical subscale (OR 3.34, 95 % CI 1.33-8.43, P value 0.01). Survivors and controls had similar rates of marriage, independent living, employment, and college attendance. CONCLUSIONS: Extremity sarcoma survivors experience high rates of physical impairment and report lower than expected physical HRQOL. However, they are as likely as peers to be married, live independently, be employed, and attend college. IMPLICATIONS FOR CANCER SURVIVORS: Follow-up for extremity sarcoma survivors should include assessment of need for further orthopedic care and rehabilitation to address cardiopulmonary and musculoskeletal health.

Role of the Substrate Specificity-Defining Residues of Human SIRT5 in Modulating the Structural Stability and Inhibitory Features of the Enzyme.

Sirtuins are emerging as the key regulators of metabolism and aging, and their potential activators and inhibitors are being explored as therapeutics for improving health and treating associated diseases. Despite the global structural similarity among all seven isoforms of sirtuins (of which most of them catalyze the deacetylation reaction), SIRT5 is the only isoform that catalyzes the cleavage of negatively charged acylated substrates, and the latter feature appears to be encoded by the presence of Tyr102 and Arg105 residues at the active site pocket of the enzyme. To determine the contributions of the above residues in SIRT5 (vis a vis the corresponding residues of SIRT1) on substrate selectivity, inhibition by EX527 and nicotinamide, secondary structural features and thermal stability of the enzymes, we created single and double mutations (viz. Y102A, R105l, and Y102A/R105I) in SIRT5. The kinetic data revealed that while Y102A mutant enzyme catalyzed both deacetylation and desuccinylation reactions with comparable efficiencies, R105I and Y102A/R105I mutant enzymes favored the deacetylase reaction. Like SIRT1, the nicotinamide inhibition of SIRT5 double mutant (Y102A/R105I) exhibited the mixed non-competitive behavior. On the other hand, the desuccinylation reaction of both wild-type and Y102A mutant enzymes conformed to the competitive inhibition model. The inhibitory potency of EX527 progressively increased from Y102A, R105I, to Y102A/R105 mutant enzymes in SIRT5, but it did not reach to the level obtained with SIRT1. The CD spectroscopic data for the wild-type and mutant enzymes revealed changes in the secondary structural features of the enzymes, and such changes were more pronounced on examining their thermal denaturation patterns. A cumulative account of our experimental data reveal mutual cooperation between Y102 and R105 residues in promoting the desuccinylation versus deacetylation reaction in SIRT5, and the overall catalytic feature of the enzyme is manifested via the mutation induced modulation in the protein structure.

High frequency organogenesis in hypocotyl, cotyledon, leaf and petiole explants of broccoli (Brassica oleracea L. var. italica), an important vegetable crop.

Broccoli (Brassica oleracea L. var. italica) is an important, nutritionally rich vegetable crop, but severely affected by environmental stresses, pests and diseases which cause massive yield and quality losses. Genetic manipulation is becoming an important method for broccoli improvement. In the present study, a reproducible and highly efficient protocol for obtaining organogenesis from hypocotyl, cotyledon, leaf and petiole explants of broccoli (Brassica oleracea L. var. italica cv. Solan green head) has been developed. Hypocotyl and cotyledon explants were used from 10 to 12 days old aseptically grown seedlings whereas leaf and petiole explants were excised from 18 to 20 days old green house grown seedlings and surface sterilized. These explants were cultured on shoot induction medium containing different concentration and combination of BAP and NAA. High efficiency shoot regeneration has been achieved in hypocotyl (83.33 %), cotyledon (90.11 %), leaf (62.96 %) and petiole (91.10 %) explants on MS medium supplemented with 3.5 mg/l BAP + 0.019 mg/l NAA 2.5 mg/l BAP + 0.5 mg/l NAA, 4.0 mg/l BAP + 0.5 mg/l NAA and 4.5 mg/l BAP + 0.019 mg/l NAA respectively. Petiole explants showed maximum shoot regeneration response as compared to other explants. MS medium supplemented with 0.10 mg/l NAA was found best for root regeneration (100 %) from in vitro developed shoots. The regenerated complete plantlets were transferred to the pots containing cocopeat and successfully acclimatized. This optimized regeneration protocol can be efficiently used for genetic transformation in broccoli. This is the first comparative report on multiple shoot induction using four different types of explants viz. hypocotyl, cotyledon, leaf and petiole.

Mechanism of N-Acylthiourea-mediated activation of human histone deacetylase 8 (HDAC8) at molecular and cellular levels.

We reported previously that an N-acylthiourea derivative (TM-2-51) serves as a potent and isozyme-selective activator for human histone deacetylase 8 (HDAC8). To probe the molecular mechanism of the enzyme activation, we performed a detailed account of the steady-state kinetics, thermodynamics, molecular modeling, and cell biology studies. The steady-state kinetic data revealed that TM-2-51 binds to HDAC8 at two sites in a positive cooperative manner. Isothermal titration calorimetric and molecular modeling data conformed to the two-site binding model of the enzyme-activator complex. We evaluated the efficacy of TM-2-51 on SH-SY5Y and BE(2)-C neuroblastoma cells, wherein the HDAC8 expression has been correlated with cellular malignancy. Whereas TM-2-51 selectively induced cell growth inhibition and apoptosis in SH-SY5Y cells, it showed no such effects in BE(2)-C cells, and this discriminatory feature appears to be encoded in the p53 genotype of the above cells. Our mechanistic and cellular studies on HDAC8 activation have the potential to provide insight into the development of novel anticancer drugs.

Bridging of a substrate between cyclodextrin and an enzyme's active site pocket triggers a unique mode of inhibition.

BACKGROUND: Methionyl-7-amino-4-methylcoumarin (MetAMC) serves as a substrate for the Escherichia coli methionine aminopeptidase (MetAP) catalyzed reaction, and is routinely used for screening compounds to identify potential antibiotic agents. In pursuit of screening the enzyme's inhibitors, we observed that 2-hydroxypropyl-ß-cyclodextrin (HP-ß-CD), utilized to solubilize hydrophobic inhibitors, inhibited the catalytic activity of the enzyme, and such inhibition was not solely due to sequestration of the substrate by HP-ß-CD. METHODS: The mechanistic path for the HP-ß-CD mediated inhibition of MetAP was probed by performing a detailed account of steady-state kinetics, ligand binding, X-ray crystallographic, and molecular modeling studies. RESULTS: X-ray crystallographic data of the ß-cyclodextrin-substrate (ß-CD-MetAMC) complex reveal that while the AMC moiety of the substrate is confined within the CD cavity, the methionine moiety protrudes outward. The steady-state kinetic data for inhibition of MetAP by HP-ß-CD-MetAMC conform to a model mechanism in which the substrate is "bridged" between HP-ß-CD and the enzyme's active-site pocket, forming HP-ß-CD-MetAMC-MetAP as the catalytically inactive ternary complex. Molecular modeling shows that the scissile bond of HP-ß-CD-bound MetAMC substrate does not reach within the proximity of the enzyme's catalytic metal center, and thus the substrate fails to undergo cleavage. CONCLUSIONS: The data presented herein suggests that the bridging of the substrate between the enzyme and HP-ß-CD cavities is facilitated by interaction of their surfaces, and the resulting complex inhibits the enzyme activity. GENERAL SIGNIFICANCE: Due to its potential interaction with physiological proteins via sequestered substrates, caution must be exercised in HP-ß-CD mediated delivery of drugs under pathophysiological conditions.

Thermodynamics of binding of structurally similar ligands to histone deacetylase 8 sheds light on challenges in the rational design of potent and isozyme-selective inhibitors of the enzyme.

Among the different histone deacetylase (HDAC) isozymes, HDAC8 is the most highly malleable enzyme, and it exhibits the potential to accommodate structurally diverse ligands (albeit with moderate binding affinities) in its active site pocket. To probe the molecular basis of this feature, we performed detailed thermodynamic studies of the binding of structurally similar ligands, which differed with respect to the "cap", "linker", and "metal-binding" regions of the suberoylanilide hydroxamic acid (SAHA) pharmacophore, to HDAC8. The experimental data revealed that although the enthalpic (ΔH°) and entropic (ΔS°) changes for the binding of individual SAHA analogues to HDAC8 were substantially different, their binding free energies (ΔG°) were markedly similar, conforming to a strong enthalpy-entropy compensation effect. This effect was further observed in the temperature-dependent thermodynamics of binding of all SAHA analogues to the enzyme. Notably, in contrast to other metalloenzymes, our isothermal titration calorimetry experiments (performed in different buffers of varying ionization enthalpies) suggest that depending on the ligand, its zinc-binding group may or may not be deprotonated upon the binding to HDAC8. Furthermore, the heat capacity changes (ΔCp°) associated with the ligand binding to HDAC8 markedly differed from one SAHA analogue to the other, and such features could primarily be rationalized in light of the dynamic flexibility in the enzyme structure in conjunction with the reorganization of the active site resident water molecules. Arguments are presented that although the binding thermodynamic features described above would facilitate identification of weak to moderately tight-binding HDAC8 inhibitors (by a high-throughput and/or virtual screening of libraries of small molecules), they would pose major challenges for the structure-based rational design of highly potent and isozyme-selective inhibitors of human HDAC8.

pH-triggered echogenicity and contents release from liposomes.

Liposomes are representative lipid nanoparticles widely used for delivering anticancer drugs, DNA fragments, or siRNA to cancer cells. Upon targeting, various internal and external triggers have been used to increase the rate for contents release from the liposomes. Among the internal triggers, decreased pH within the cellular lysosomes has been successfully used to enhance the rate for releasing contents. However, imparting pH sensitivity to liposomes requires the synthesis of specialized lipids with structures that are substantially modified at a reduced pH. Herein, we report an alternative strategy to render liposomes pH sensitive by encapsulating a precursor which generates gas bubbles in situ in response to acidic pH. The disturbance created by the escaping gas bubbles leads to the rapid release of the encapsulated contents from the liposomes. Atomic force microscopic studies indicate that the liposomal structure is destroyed at a reduced pH. The gas bubbles also render the liposomes echogenic, allowing ultrasound imaging. To demonstrate the applicability of this strategy, we have successfully targeted doxorubicin-encapsulated liposomes to the pancreatic ductal carcinoma cells that overexpress the folate receptor on the surface. In response to the decreased pH in the lysosomes, the encapsulated anticancer drug is efficiently released. Contents released from these liposomes are further enhanced by the application of continuous wave ultrasound (1 MHz), resulting in substantially reduced viability for the pancreatic cancer cells (14%).

Bone mineral density among long-term survivors of childhood acute lymphoblastic leukemia: results from the St. Jude Lifetime Cohort Study.

BACKGROUND: The prevalence of low bone mineral density (BMD) in adult survivors of childhood acute lymphoblastic leukemia (ALL), and the degree of recovery or decline, are not well elucidated. PROCEDURE: Study subjects (age ≥ 18 years and ≥10 years post-diagnosis) participated in an institutional follow-up protocol and risk-based clinical evaluation based on Children's Oncology Group guidelines. Trabecular volumetric BMD was ascertained using quantitative computed tomography, reported as age- and sex-specific Z-scores. RESULTS: At median age 31 years, 5.7% of 845 subjects had a BMD Z-score of ≤-2 and 23.8% had a Z-score of -1 to -2. Cranial radiation dose of ≥24 Gy, but not cumulative methotrexate or prednisone equivalence doses, was associated with a twofold elevated risk of a BMD Z-score of ≤-1. The cranial radiation effect was stronger in females than in males. In a subset of 400 subjects, 67% of those who previously had a BMD Z-score of ≤-2 improved by one or more categories a median of 8.5 years later. CONCLUSIONS: Very low BMD was relatively uncommon in this sample of adult survivors of childhood ALL, and BMD Z-scores tended to improve from adolescence to young adulthood. High-dose cranial or craniospinal radiation exposure was the primary predictor of suboptimal BMD in our study. Given that cranial radiation treatment for childhood ALL is used far more sparingly now than in earlier treatment eras, concerns about persistently low BMD among most current childhood ALL patients may be unwarranted.